Text to DNA Converter

Your name, text, even credit card number... DNA encrypted.

You can convert any text into DNA sequence. That means you can also synthesize the sequence and put it into a bacteria!









Who did this? "TTAGTCTTTGCTTCCTTGTAACAATTCCTCGGTGAC"

This is the HOW TO and you know what you do: "TTTATCCATCTTACAATCTTTCGCTCAGTGACTGCTTGAATGTATCCTTCGGTCGCACAATGAATCTTTGACTCTCTCGGTGACTCGTTCTTTCTAACAATCTCTGACTCGGTCGTACAATGTTTGTATCTCACGTAGCAACAATCTTTCGCTCAGTCGGTCTATCTTTCTAACAATGTATCTTTGCATGTAACAATGTATCGGACAATCACTCCTTCGCTCATTGACTGCTACAATGTATCGGACAATATATAGCTAATACAATGTGTCCTTGTATCCAACAATAATACAATCATTGAGACAAAGAAAGAAACGAACAATTTAACAATCATTGAGACAAAGAAAGATACGAACAATATGACAATCATTGAGACAAAGATAGATACGAACAATAAGACAATCATTGAGACAAAGATAGAA"